Erratum note: Unfortunately, the original version of this article [1] contained an error. In the Methods part, in the Design and Cloning of Plasmids section, a sentence was included incorrectly. The correct sentence can be found below/n/n"The Insert-2 sequence was previously assembled from four 5'-phosphorilated oligonucleotides (IDT)"./n/nPlease also note in table S3 The oligo pDECKO_seq_R is lacking one nucleotide. The correct sequence is ATGTCTACTATTCTTTCCCC

Background. CRISPR genome-editing technology makes it possible to quickly and cheaply delete non-protein-coding regulatory elements. We present a vector system adapted for this purpose called DECKO (Double Excision CRISPR Knockout), which applies a simple two-step cloning to generate lentiviral vectors expressing two guide RNAs (gRNAs) simultaneously. The key feature of DECKO is its use of a single 165 bp starting oligonucleotide carrying the variable sequences of both gRNAs, making it fully scalable from single-locus studies to complex library cloning./nResults. We apply DECKO to deleting the promoters of one protein-coding gene and two oncogenic lncRNAs, UCA1 and the highly-expressed MALAT1, focus of many previous studies employing RNA interference approaches. DECKO successfully deleted genomic fragments ranging in size from 100 to 3000 bp in four human cell lines. Using a clone-derivation workflow lasting approximately 20 days, we obtained 9 homozygous and 17 heterozygous promoter knockouts in three human cell lines. Frequent target region inversions were observed. These clones have reductions in steady-state MALAT1 RNA levels of up to 98 % and display reduced proliferation rates./nConclusions. We present a dual CRISPR tool, DECKO, which is cloned using a single starting oligonucleotide, thereby affording simplicity and scalability to CRISPR knockout studies of non-coding genomic elements, including long non-coding RNAs.

We acknowledge support of the Spanish Ministry of Economy and Competitiveness, ‘Centro de Excelencia Severo Ochoa 2013-2017’, SEV-2012-0208. This work was financially supported by the following grants: CSD2007-00050 from the Spanish Ministry of Science, grant SGR-1430 from the Catalan Government, grant ERC-2011-AdG-294653-RNA-MAPS from the European Community financial support under the FP7 and grant R01MH101814 by the National Human Genome Research Institute of the National Institutes of Health, to RG. Ramón y Cajal RYC-2011-08851 and Plan Nacional BIO2011-27220 to RJ.